|
ASO Corporation
zif268 aso ![]() Zif268 Aso, supplied by ASO Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pmc02991235-102-7-8?v=ASO+Corporation Average 90 stars, based on 1 article reviews
zif268 aso - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
GeneDireX Inc
48-bp single-stranded dna oligonucleotides ![]() 48 Bp Single Stranded Dna Oligonucleotides, supplied by GeneDireX Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pmc06788601-66-1-45?v=GeneDireX+Inc Average 90 stars, based on 1 article reviews
48-bp single-stranded dna oligonucleotides - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Promega
the double-stranded dna oligonucleotide probes for the gel shift experiments ![]() The Double Stranded Dna Oligonucleotide Probes For The Gel Shift Experiments, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/10__1128_slash_mcb__17__5__2550-63-2-18?v=Promega Average 90 stars, based on 1 article reviews
the double-stranded dna oligonucleotide probes for the gel shift experiments - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ValueGene
biotinylated double-stranded 29-mer oligonucleotides biotin 3' end dna labeling kit ![]() Biotinylated Double Stranded 29 Mer Oligonucleotides Biotin 3' End Dna Labeling Kit, supplied by ValueGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pmc02844968-61-2-4?v=ValueGene Average 90 stars, based on 1 article reviews
biotinylated double-stranded 29-mer oligonucleotides biotin 3' end dna labeling kit - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Midland Certified Reagent
hex-labeled double-stranded oligonucleotide dna ![]() Hex Labeled Double Stranded Oligonucleotide Dna, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pmc04867230-146-50-59?v=Midland+Certified+Reagent Average 90 stars, based on 1 article reviews
hex-labeled double-stranded oligonucleotide dna - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
hplc-purified single-stranded synthetic dna oligonucleotides specifying a 79-bp mtdna amplicon and a 97 gapdh amplicon ![]() Hplc Purified Single Stranded Synthetic Dna Oligonucleotides Specifying A 79 Bp Mtdna Amplicon And A 97 Gapdh Amplicon, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/10__1590_slash_s1415___47572009000100003-52-11-16?v=Microsynth+ag Average 90 stars, based on 1 article reviews
hplc-purified single-stranded synthetic dna oligonucleotides specifying a 79-bp mtdna amplicon and a 97 gapdh amplicon - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
hplcpuriwed single-stranded synthetic dna oligonucleotides specifying a 97-bp gapdh amplicon ![]() Hplcpuriwed Single Stranded Synthetic Dna Oligonucleotides Specifying A 97 Bp Gapdh Amplicon, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pm19125299-35-25-21?v=Microsynth+ag Average 90 stars, based on 1 article reviews
hplcpuriwed single-stranded synthetic dna oligonucleotides specifying a 97-bp gapdh amplicon - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Promega
5’-labelled double-stranded 22-mer oligonucleotide containing the nf-kb dna-binding site ![]() 5’ Labelled Double Stranded 22 Mer Oligonucleotide Containing The Nf Kb Dna Binding Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pm08243641-43-48-55?v=Promega Average 90 stars, based on 1 article reviews
5’-labelled double-stranded 22-mer oligonucleotide containing the nf-kb dna-binding site - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Sigma-Genosys
phosphorothioate single-stranded dna oligonucleotides ![]() Phosphorothioate Single Stranded Dna Oligonucleotides, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/10__1074_slash_jbc__m301886200-65-2-7?v=Sigma-Genosys Average 90 stars, based on 1 article reviews
phosphorothioate single-stranded dna oligonucleotides - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Viagene Inc
double stranded dna oligonucleotides containing the ap4 binding site found in the laptm4b promoter (sense: 5′ ggagctccagcagctggctggagcc 3′) ![]() Double Stranded Dna Oligonucleotides Containing The Ap4 Binding Site Found In The Laptm4b Promoter (Sense: 5′ Ggagctccagcagctggctggagcc 3′), supplied by Viagene Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pmc05830630-32-1-27?v=Viagene+Inc Average 90 stars, based on 1 article reviews
double stranded dna oligonucleotides containing the ap4 binding site found in the laptm4b promoter (sense: 5′ ggagctccagcagctggctggagcc 3′) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Promega
double-stranded dna oligonucleotides containing the nf-κb and antioxidant response element (are) consensus sequence ![]() Double Stranded Dna Oligonucleotides Containing The Nf κb And Antioxidant Response Element (Are) Consensus Sequence, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pmc09913664-94-5-13?v=Promega Average 90 stars, based on 1 article reviews
double-stranded dna oligonucleotides containing the nf-κb and antioxidant response element (are) consensus sequence - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Promega
double strand dna oligonucleotides containing consensus sequences for nf-κb and activator protein 1 (ap-1) ![]() Double Strand Dna Oligonucleotides Containing Consensus Sequences For Nf κb And Activator Protein 1 (Ap 1), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/double+stranded+dna+oligonucleotide/pmc06782699-83-8-14?v=Promega Average 90 stars, based on 1 article reviews
double strand dna oligonucleotides containing consensus sequences for nf-κb and activator protein 1 (ap-1) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Behavioral Neuroscience
Article Title: Memory Reconsolidation Mediates the Updating of Hippocampal Memory Content
doi: 10.3389/fnbeh.2010.00168
Figure Lengend Snippet: Expression of BDNF (A) and Zif268 (B) proteins . Western blot analysis of dorsal hippocampal protein levels 2 h after final behavioral session in five groups. 1 – behaviorally naïve, 2 – context pre-exposure alone, 3 – immediate shock alone, 4 – context pre-exposure followed the next day by immediate shock, 5 – context pre-exposure followed the next day by re-exposure to the context alone. Learning the context representation selectively engages BDNF, whereas associating the retrieved memory of the context with the footshock upregulates Zif268 ( n = 4 per group). Data presented as mean + S.E.M. (* p < 0.05).
Article Snippet: The lack of contextual freezing in the
Techniques: Expressing, Western Blot
Journal: Frontiers in Behavioral Neuroscience
Article Title: Memory Reconsolidation Mediates the Updating of Hippocampal Memory Content
doi: 10.3389/fnbeh.2010.00168
Figure Lengend Snippet: Acquisition of the contextual representation requires BDNF, but not Zif268 . Knockdown of BDNF, but not Zif268, in the dorsal hippocampus during context pre-exposure impaired the subsequent ability of rats to retrieve the memory of the context in order to associate it with the footshock, and hence BDNF knockdown rats froze significantly less at the context fear memory test ( n = 5–6 per group). Data presented as mean + S.E.M.
Article Snippet: The lack of contextual freezing in the
Techniques: Knockdown
Journal: Frontiers in Behavioral Neuroscience
Article Title: Memory Reconsolidation Mediates the Updating of Hippocampal Memory Content
doi: 10.3389/fnbeh.2010.00168
Figure Lengend Snippet: Updating the contextual representation requires memory destabilization and reconsolidation . (A) Rats were pre-exposed to the context, and then infused into the dorsal hippocampus at the time of a subsequent immediate shock, with the updated memory assessed in a contextual fear test. Whereas knockdown of BDNF had no effect, knockdown of Zif268 and inhibition of synaptic protein degradation (β-lac) both significantly impaired contextual freezing. Zif268 knockdown no longer had an effect when delayed by 4 h after the immediate shock session ( n = 5–6 per group). (B) Retraining of the impaired rats. The groups showing an impairment were retrained the next week with further immediate shock and context fear test sessions to assess the integrity of the original contextual representation. The Zif268 knockdown group remained significantly impaired, whereas previous inhibition of synaptic protein degradation did not impair the ability of retraining to associate the immediate footshock with the intact retrieved context memory ( n = 5–6 per group). (C) Extent of context pre-exposure required to mitigate the immediate shock deficit. The normal pre-exposure used during training results in high levels of subsequent freezing compared to rats given no pre-exposure and only experiencing the immediate shock. A single 5-min short context pre-exposure failed to overcome the immediate shock deficit ( n = 4 per group). Data presented as mean + S.E.M.
Article Snippet: The lack of contextual freezing in the
Techniques: Knockdown, Inhibition
Journal: Frontiers in Behavioral Neuroscience
Article Title: Memory Reconsolidation Mediates the Updating of Hippocampal Memory Content
doi: 10.3389/fnbeh.2010.00168
Figure Lengend Snippet: Reconsolidation is only engaged under conditions of memory updating . (A) Rats were pre-exposed to the context and then re-exposed to the context following knockdown of Zif268. No effect was observed in the subsequent context fear memory test ( n = 6 per group). (B) Rats were given a shorter initial exposure to the context, and then were re-exposed to the context. Knockdown of Zif268 impaired the subsequent ability of a footshock to be associated with the retrieved memory of the context ( n = 5–6 per group). (C) Rats were given a footshock at the end of each pre-exposure to the context, and then Zif268 was knocked down during a subsequent immediate shock session. No effect was observed in the subsequent context fear memory test ( n = 5–6 per group). Data presented as mean + S.E.M.
Article Snippet: The lack of contextual freezing in the
Techniques: Knockdown